The name of the query motif.
The alternate name of the query motif.
A link to more information about the query motif.
The motif preview. On supporting browsers this will display as a motif logo, otherwise the consensus sequence will be displayed.
The number of significant matches of the query motif to a motif in the target database.
Links to the first 20 matches of the query motif to a motif in the target database.
The database name.
The number of motifs read from the motif database minus the number that had to be discarded due to conflicting IDs.
The number of motifs that had a match with at least one of the query motifs.
The summary gives information about the matched motif. Mouse over each row to show further help buttons for each specific title.
The name of the matched motif.
The alternative name of the matched motif.
The database containing the matched motif.
The probability that the match occurred by random chance according to the null model.
The expected number of false positives in the matches up to this point.
The minimum False Discovery Rate required to include the match.
The number of letters that overlaped in the optimal alignment.
The offset of the query motif to the matched motif in the optimal alignment.
The orientation of the matched motif that gave the optimal alignment. A value of "normal" means that the matched motif is as it appears in the database otherwise the matched motif has been reverse complemented.
The image shows the alignment of the two motifs. The matched motif is shown on the top and the query motif is shown on the bottom.
By clicking the link "Create custom LOGO ↧" a form to make custom logos will be displayed. The download button can then be clicked to generate a motif matching the selected specifications.
Two image formats, png and eps, are avaliable. The pixel based portable network graphic (png) format is commonly used on the Internet and the Encapsulated PostScript (eps) format is more suitable for publications that might require scaling.
Toggle error bars indicating the confidence of a motif based on the number of sites used in its creation.
Toggle adding pseudocounts for Small Sample Correction.
Toggle a full reverse complement of the alignment.
Specify the width of the generated logo.
Specify the height of the generated logo.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use TOMTOM in your research, please cite the following paper:
Shobhit Gupta, JA Stamatoyannopolous, Timothy Bailey and William Stafford Noble,
"Quantifying similarity between motifs",
Genome Biology, 8(2):R24, 2007.
[full text]
Query Motifs |
Next Top |
Name |
Alt. Name |
Preview |
Matches |
List |
| 1 | MEME |
CAGCCACACCCA
|
2 | MA0039.2 (Klf4), MA0333.1 (MET31) |
| 2 | MEME |
CAGATAAG
|
6 | MA0035.2 (Gata1), MA0140.1 (Tal1::Gata1), MA0300.1 (GAT1), MA0307.1 (GLN3), MA0309.1 (GZF3), MA0439.1 (YRR1) |
| 3 | MEME |
CTGCATCTCTTCAAGACACACCTAACTGC
|
0 |
Target Databases |
Previous Next Top |
Database |
Number of Motifs |
Motifs Matched |
| JASPAR_CORE_2009.meme | 476 | 8 |
Matches to Query: 1 (MEME) |
Previous Next Top |
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Next Match] [Query Top] | ||||||||||||||||||
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Previous Match] [Query Top] |
Matches to Query: 2 (MEME) |
Previous Next Top |
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Next Match] [Query Top] | ||||||||||||||||||
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Previous Match] [Next Match] [Query Top] | ||||||||||||||||||
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Previous Match] [Next Match] [Query Top] | ||||||||||||||||||
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Previous Match] [Next Match] [Query Top] | ||||||||||||||||||
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Previous Match] [Next Match] [Query Top] | ||||||||||||||||||
Summary |
Alignment |
||||||||||||||||||
|
![]() |
||||||||||||||||||
| Create custom LOGO ↧ | [Previous Match] [Query Top] |
Matches to Query: 3 (MEME) |
Previous Next Top |