The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| 2 (MEME) |
CAGATAAG
|
7 | MA0039.2 (Klf4), 3 (MEME), MA0268.1 (ADR1), MA0370.1 (RME1), MA0137.1 (STAT1), MA0436.1 (YPR022C), MA0355.1 (PHD1) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| sample-dna-Klf1 | Tue Oct 7 14:14:10 2014 | 904 | 0 | 520 | 55 | 329 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Tue Oct 7 17:17:30 2014 | 2 | 1 | 1 |
| dreme.xml | Tue Oct 7 17:17:48 2014 | 3 | 0 | 1 |
| JASPAR CORE 2009 | Wed Dec 5 17:04:00 2012 | 476 | 6 | 3 |
Spacings of "MA0039.2 (Klf4)" relative to "2 (MEME)" |
Previous Next Top |
| Primary: 2 (MEME) | Secondary: MA0039.2 (Klf4) | E-value |
|---|---|---|
|
CAGATAAG
|
TGGGTGGGGC
|
0.014 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif278Motif DatabaseJASPAR CORE 2009 |
|||||||||||||||||||
| Similar Secondary: 1 (MEME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif254Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: GGGYGK (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif286Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0425.1 (YGR067C) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif183Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0337.1 (MIG1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif221Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0339.1 (MIG3) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif221Alignment by most significant spacings
|
|||||||||||||||
Spacings of "3 (MEME)" relative to "2 (MEME)" |
Previous Next Top |
| Primary: 2 (MEME) | Secondary: 3 (MEME) | E-value |
|---|---|---|
|
CAGATAAG
|
CTGCATCTCTTCAAGACACACCTAACTGC
|
0.04 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6Motif Databasememe.xml |
|||||||||||
Spacings of "MA0268.1 (ADR1)" relative to "2 (MEME)" |
Previous Next Top |
| Primary: 2 (MEME) | Secondary: MA0268.1 (ADR1) | E-value |
|---|---|---|
|
CAGATAAG
|
ACCCCAC
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif283Motif DatabaseJASPAR CORE 2009 |
|||||||||||
Spacings of "MA0370.1 (RME1)" relative to "2 (MEME)" |
Previous Next Top |
| Primary: 2 (MEME) | Secondary: MA0370.1 (RME1) | E-value |
|---|---|---|
|
CAGATAAG
|
TCCAAAGGAA
|
4.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif175Motif DatabaseJASPAR CORE 2009 |
|||||||||||
Spacings of "MA0137.1 (STAT1)" relative to "2 (MEME)" |
Previous Next Top |
| Primary: 2 (MEME) | Secondary: MA0137.1 (STAT1) | E-value |
|---|---|---|
|
CAGATAAG
|
GGAAAATGAAACTG
|
5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif28Motif DatabaseJASPAR CORE 2009 |
|||||||||||
Spacings of "MA0436.1 (YPR022C)" relative to "2 (MEME)" |
Previous Next Top |
| Primary: 2 (MEME) | Secondary: MA0436.1 (YPR022C) | E-value |
|---|---|---|
|
CAGATAAG
|
CCCCACG
|
5.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif186Motif DatabaseJASPAR CORE 2009 |
|||||||||||
Spacings of "MA0355.1 (PHD1)" relative to "2 (MEME)" |
Previous Next Top |
| Primary: 2 (MEME) | Secondary: MA0355.1 (PHD1) | E-value |
|---|---|---|
|
CAGATAAG
|
ACCTGCAGCA
|
7.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif199Motif DatabaseJASPAR CORE 2009 |
|||||||||||