bowtie2 alignerbowtie2-build indexerbowtie2-inspect index inspectorBowtie 2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index (based on the Burrows-Wheeler Transform or BWT) to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 gigabytes of RAM. Bowtie 2 supports gapped, local, and paired-end alignment modes. Multiple processors can be used simultaneously to achieve greater alignment speed. Bowtie 2 outputs alignments in SAM format, enabling interoperation with a large number of other tools (e.g. SAMtools, GATK) that use SAM. Bowtie 2 is distributed under the GPLv3 license, and it runs on the command line under Windows, Mac OS X and Linux.
Bowtie 2 is often the first step in pipelines for comparative genomics, including for variation calling, ChIP-seq, RNA-seq, BS-seq. Bowtie 2 and Bowtie (also called "Bowtie 1" here) are also tightly integrated into some tools, including TopHat: a fast splice junction mapper for RNA-seq reads, Cufflinks: a tool for transcriptome assembly and isoform quantitiation from RNA-seq reads, Crossbow: a cloud-enabled software tool for analyzing reseuqncing data, and Myrna: a cloud-enabled software tool for aligning RNA-seq reads and measuring differential gene expression.
If you use Bowtie 2 for your published research, please cite the Bowtie paper. Thank you!
Bowtie 1 was released in 2009 and was geared toward aligning the relatively short sequencing reads (up to 25-50 nucleotides) prevalent at the time. Since then, technology has improved both sequencing throughput (more nucleotides produced per sequencer per day) and read length (more nucleotides per read).
The chief differences between Bowtie 1 and Bowtie 2 are:
For reads longer than about 50 bp Bowtie 2 is generally faster, more sensitive, and uses less memory than Bowtie 1. For relatively short reads (e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or more sensitive.
Bowtie 2 supports gapped alignment with affine gap penalties. Number of gaps and gap lengths are not restricted, except by way of the configurable scoring scheme. Bowtie 1 finds just ungapped alignments.
Bowtie 2 supports local alignment, which doesn't require reads to align end-to-end. Local alignments might be "trimmed" ("soft clipped") at one or both extremes in a way that optimizes alignment score. Bowtie 2 also supports end-to-end alignment which, like Bowtie 1, requires that the read align entirely.
There is no upper limit on read length in Bowtie 2. Bowtie 1 had an upper limit of around 1000 bp.
Bowtie 2 allows alignments to overlap ambiguous characters (e.g. Ns) in the reference. Bowtie 1 does not.
Bowtie 2 does away with Bowtie 1's notion of alignment "stratum", and its distinction between "Maq-like" and "end-to-end" modes. In Bowtie 2 all alignments lie along a continuous spectrum of alignment scores where the scoring scheme, similar to Needleman-Wunsch and Smith-Waterman.
Bowtie 2's paired-end alignment is more flexible. E.g. for pairs that do not align in a paired fashion, Bowtie 2 attempts to find unpaired alignments for each mate.
Bowtie 2 reports a spectrum of mapping qualities, in contrast fo Bowtie 1 which reports either 0 or high.
Bowtie 2 does not align colorspace reads.
Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's command-line arguments and genome index format are both different from Bowtie 1's.
Bowtie 1 and Bowtie 2 are not general-purpose alignment tools like MUMmer, BLAST or Vmatch. Bowtie 2 works best when aligning to large genomes, though it supports arbitrarily small reference sequences (e.g. amplicons). It handles very long reads (i.e. upwards of 10s or 100s of kilobases), but it is optimized for the read lengths and error modes yielded by recent sequencers, such as the Illumina HiSeq 2000, Roche 454, and Ion Torrent instruments.
If your goal is to align two very large sequences (e.g. two genomes), consider using MUMmer. If your goal is very sensitive alignment to a relatively short reference sequence (e.g. a bacterial genome), this can be done with Bowtie 2 but you may want to consider using tools like NUCmer, BLAT, or BLAST. These tools can be extremely slow when the reference genome is long, but are often adequate when the reference is short.
Bowtie 2 does not support alignment of colorspace reads. This might be supported in future versions.
We say Bowtie 2 is in "beta" to convey that it is not as polished as a tool that has been around for a while, and it's still in flux. Features, file formats, and performance characteristics (speed, sensitivity, and accuracy) may change from release to release until the "beta" disgnation is removed.
Download Bowtie 2 sources and binaries from the Download section of the Sourceforge site. Binaries are available for Intel architectures (i386 and x86_64) running Linux, and Mac OS X. A 32-bit version is available for Windows. If you plan to compile Bowtie 2 yourself, make sure to get the source package, i.e., the filename that ends in "-source.zip".
Building Bowtie 2 from source requires a GNU-like environment with GCC, GNU Make and other basics. It should be possible to build Bowtie 2 on most vanilla Linux installations or on a Mac installation with Xcode installed. Bowtie 2 can also be built on Windows using Cygwin or MinGW (MinGW recommended). If building with MinGW, first install MinGW and MSYS, the zlib library, and the pthreads library. You may also need the GnuWin32 core and other utilities to drive the build process.
First, download the source package from the sourceforge site. Make sure you're getting the source package; the file downloaded should end in -source.zip. Unzip the file, change to the unzipped directory, and build the Bowtie 2 tools by running GNU make (usually with the command make, but sometimes with gmake) with no arguments. If building with MinGW, run make from the MSYS environment.
To support the -p (multithreading) option, Bowtie 2 needs the pthreads library. To compile Bowtie 2 without pthreads (which disables -p), use make BOWTIE_PTHREADS=0.
By adding your new Bowtie 2 directory to your PATH environment variable, you ensure that whenever you run bowtie2, bowtie2-build or bowtie2-inspect from the command line, you will get the version you just installed without having to specify the entire path. This is recommended for most users. To do this, follow your operating system's instructions for adding the directory to your PATH.
If you would like to install Bowtie 2 by copying the Bowtie 2 executable files to an existing directory in your PATH, make sure that you copy all the executables, including bowtie2, bowtie2-align, bowtie2-build and bowtie2-inspect.
bowtie2 alignerbowtie2 takes a Bowtie 2 index and a set of sequencing read files and outputs a set of alignments in SAM format.
"Alignment" is the process by which we discover how and where the read sequences are similar to the reference sequence. An "alignment" is a result from this process, specifically: an alignment is a way of "lining up" some or all of the characters in the read with some characters from the reference in a way that reveals how they're similar. For example:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
Where dash symbols represent gaps and vertical bars show where aligned characters match.
We use alignment to make an educated guess as to where a read originated with respect to the reference genome. It's not always possible to determine this with certainty. For instance, if the reference genome contains several long stretches of As (AAAAAAAAA etc) and the read sequence is a short stretch of As (AAAAAAA), we cannot know for certain exactly where in the sea of As the read originated.
By default, Bowtie 2 performs end-to-end read alignment. That is, it searches for alignments involving all of the read characters. This is also called an "untrimmed" or "unclipped" alignment.
When the --local option is specified, Bowtie 2 performs local read alignment. In this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both ends of the alignment if doing so maximizes the alignment score.
The following is an "end-to-end" alignment because it involves all the characters in the read. Such an alignment can be produced by Bowtie 2 in either end-to-end mode or in local mode.
Read: GACTGGGCGATCTCGACTTCG
Reference: GACTGCGATCTCGACATCG
Alignment:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
The following is a "local" alignment because some of the characters at the ends of the read do not participate. In this case, 4 characters are omitted (or "soft trimmed" or "soft clipped") from the beginning and 3 characters are omitted from the end. This sort of alignment can be produced by Bowtie 2 only in local mode.
Read: ACGGTTGCGTTAATCCGCCACG
Reference: TAACTTGCGTTAAATCCGCCTGG
Alignment:
Read: ACGGTTGCGTTAA-TCCGCCACG
||||||||| ||||||
Reference: TAACTTGCGTTAAATCCGCCTGG
An alignment score quantifies how similar the read sequence is to the reference sequence aligned to. The higher the score, the more similar they are. A score is calculated by subtracting penalties for each difference (mismatch, gap, etc) and, in local alignment mode, adding bonuses for each match.
The scores can be configured with the --ma (match bonus), --mp (mismatch penalty), --np (penalty for having an N in either the read or the reference), --rdg (affine read gap penalty) and --rfg (affine reference gap penalty) options.
A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). Thus, in end-to-end alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score is -(6 + 11) = -17.
The best possible alignment score in end-to-end mode is 0, which happens when there are no differences between the read and the reference.
A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). A base that matches receives a bonus of +2 be default. Thus, in local alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score equals the total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.
The best possible score in local mode equals the match bonus times the length of the read. This happens when there are no differences between the read and the reference.
For an alignment to be considered "valid" (i.e. "good enough") by Bowtie 2, it must have an alignment score no less than the minimum score threshold. The threshold is configurable and is expressed as a function of the read length. In end-to-end alignment mode, the default minimum score threhsold is -0.6 + -0.6 * L, where L is the read length. In local alignment mdoe, the default minimum score threshold is 20 + 8.0 * ln(L), where L is the read length. This can be configured with the --score-min option. For details on how to set options like --score-min that correpond to functions, see the section on setting function options.
The aligner cannot always assign a read to its point of origin with high confidence. For instance, a read that originated inside a repeat element might align equally well to many occurrences of the element throughout the genome, leaving the aligner with no basis for preferring one over the others.
Aligners characterize their degree of confidence in the point of origin by reporting a mapping quality: a non-negative integer Q = -10 log10 p, where p is an estimate of the probability that the alignment does not correspond to the read's true point of origin. Mapping quality is sometimes abbreviated MAPQ, and is recorded in the SAM MAPQ field.
Mapping quality is related to "uniqueness." We say an alignment is unique if it has a much higher alignment score than all the other possible alignments. The bigger the gap between the best alignment's score and the second-best alignment's score, the more unique the best alignment, and the higher its mapping quality should be.
Accurate mapping qualities are useful for downstream tools like variant callers. For instance, a variant caller might choose to ignore evidence from alignments with mapping quality less than, say, 10. A mapping quality of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere.
A "paired-end" or "mate-pair" read consists of pair of mates, called mate 1 and mate 2. Pairs come with a prior expectation about (a) the relative orientation of the mates, and (b) the distance separating them on the original DNA molecule. Exactly what expectations hold for a given dataset depends on the lab procedures used to generate the data. For example, a common lab procedure for producing pairs is Illumina's Paired-end Sequencing Assay, which yields pairs with a relative orientation of FR ("forward, reverse") meaning that if mate 1 came from the Watson strand, mate 2 very likely came from the Crick strand and vice versa. Also, this protocol yields pairs where the expected genomic distance from end to end is about 200-500 base pairs.
For simplicity, this manual uses the term "paired-end" to refer to any pair of reads with some expected relative orientation and distance. Depending on the protocol, these might actually be referred to as "paired-end" or "mate-paired." Also, we always refer to the individual sequences making up the pair as "mates."
Pairs are often stored in a pair of files, one file containing the mate 1s and the other containing the mates 2s. The first mate in the file for mate 1 forms a pair with the first mate in the file for mate 2, the second with the second, and so on. When aligning pairs with Bowtie 2, specify the file with the mate 1s mates using the -1 argument and the file with the mate 2s using the -2 argument. This causes Bowtie 2 to take the paired nature of the reads into account when aligning them.
When Bowtie 2 prints a SAM alignment for a pair, it prints two records (i.e. two lines of output), one for each mate. The first record describes the alignment for mate 1 and the second record describes the alignment for mate 2. In both records, some of the fields of the SAM record describe various properties of the alignment; for instance, the 7th and 8th fields (RNEXT and PNEXT respectively) indicate the reference name and position where the other mate aligned, and the 9th field indicates the inferred length of the DNA fragment from which the two mates were sequenced. See the SAM specification for more details regarding these fields.
A pair that aligns with the expected relative mate orientation and with the expected range of distances between mates is said to align "concordantly". If both mates have unique alignments, but the alignments do not match paired-end expectations (i.e. the mates aren't in the expcted relative orientation, or aren't within the expected disatance range, or both), the pair is said to align "discordantly". Discordant alignments may be of particular interest, for instance, when seeking structural variants.
The expected relative orientation of the mates is set using the --ff, --fr, or --rf options. The expected range of inter-mates distances (as measured from the furthest extremes of the mates; also called "outer distance") is set with the -I and -X options.
To declare that a pair aligns discordantly, Bowtie 2 requires that both mates align uniquely. This is a conservative threshold, but this is often desirable when seeking structural variants.
By default, Bowtie 2 searches for both concordant and discordant alignments, though searching for discordant alignments can be disabled with the --no-discordant option.
If Bowtie 2 cannot find a paired-end alignment for a pair, by default it will go on to look for unpaired alignments for the constituent mates. This is called "mixed mode." To disable mixed mode, set the --no-mixed option.
Bowtie 2 runs a little faster in --no-mixed mode, but will only consider alignment status of pairs per se, not individual mates.
The SAM FLAGS field, the second field in a SAM record, has multiple bits that describe the paired-end nature of the read and alignment. The first (least significant) bit (1 in decimal, 0x1 in hexidecimal) is set if the read is part of a pair. The second bit (2 in decimal, 0x2 in hexidecimal) is set if the read is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in hexidecimal) is set if the read is part of a pair and the other mate in the pair had at least one valid alignment. The sixth bit (32 in decimal, 0x20 in hexidecimal) is set if the read is part of a pair and the other mate in the pair aligned to the Crick strand (or, equivalently, if the reverse complement of the other mate aligned to the Watson strand). The seventh bit (64 in decimal, 0x40 in hexidecimal) is set if the read is mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexidecimal) is set if the read is mate 2 in a pair. See the SAM specification for a more detailed description of the FLAGS field.
The last severeal fields of each SAM record usually contain SAM optional fields, which are simply tab-separated strings conveying additional information about the reads and alignments. A SAM optional field is formatted like this: "XP:i:1" where "XP" is the TAG, "i" is the TYPE ("integer" in this case), and "1" is the VALUE. See the SAM specification for details regarding SAM optional fields.
The fragment and read lengths might be such that alignments for the two mates from a pair overlap each other. Consider this example:
(For these examples, assume we expect mate 1 to align to the left of mate 2.)
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTT
Mate 2: TGTTTGGGGTGACACATTACGCGTCTTTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
It's also possible, though unusual, for one mate alignment to contain the other, as in these examples:
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TGTTTGGGGTGACACATTACGC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
Mate 1: CAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: CTACGATATTGTTTGGGGTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
And it's also possible, though unusual, for the mates to "dovetail", with the mates seemingly extending "past" each other as in this example:
Mate 1: GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
In some situations, it's desirable for the aligner to consider all these cases as "concordant" as long as other paired-end constraints are not violated. Bowtie 2's default behavior is to consider overlapping and containing as being consistent with concordant alignment. By default, dovetailing is considered inconsistent with concordant alignment.
These defaults can be overridden. Setting --no-overlap causes Bowtie 2 to consider overlapping mates as non-concordant. Setting --no-contain causes Bowtie 2 to consider cases where one mate alignment contains the other as non-concordant. Setting --dovetail causes Bowtie 2 to consider cases where the mate alignments dovetail as concordant.
The reporting mode governs how many alignments Bowtie 2 looks for, and how to report them. Bowtie 2 has three distinct reporting modes. The default reporting mode is similar to the default reporting mode of many other read alignment tools, including BWA. It is also similar to Bowtie 1's -M alignment mode.
In general, when we say that a read has an alignment, we mean that it has a valid alignment. When we say that a read has multiple alignments, we mean that it has multiple alignments that are valid and distinct from one another.
Two alignments for the same individual read are "distinct" if they map the same read to different places. Specifically, we say that two alignments are distinct if there are no alignment positions where a particular read offset is aligned opposite a particular reference offset in both alignments with the same orientation. E.g. if the first alignment is in the forward orientation and aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, and the second alignment is also in the forward orientation and also aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, they are not distinct alignments.
Two alignments for the same pair are distinct if either the mate 1s in the two paired-end alignments are distinct or the mate 2s in the two alignments are distinct or both.
By default, Bowtie 2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it generally will continue to look for alignments that are nearly as good or better. It will eventually stop looking, either because it exceeded a limit placed on search effort (see -D and -R) or because it already knows all it needs to know to report an alignment. Information from the best alignments are used to estimate mapping quality (the MAPQ SAM field) and to set SAM optional fields, such as AS:i and XS:i. Bowtie 2 does not gaurantee that the alignment reported is the best possible in terms of alignment score.
See also: -D, which puts an upper limit on the number of dynamic programming problems (i.e. seed extensions) that can "fail" in a row before Bowtie 2 stops searching. Increasing -D makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.
See also: -R, which sets the maximum number of times Bowtie 2 will "re-seed" when attempting to align a read with repetitive seeds. Increasing -R makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.
In -k mode, Bowtie 2 searches for up to N distinct, valid alignments for each read, where N equals the integer specified with the -k parameter. That is, if -k 2 is specified, Bowtie 2 will search for at most 2 distinct alignments. It reports all alignments found, in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. See the SAM specification for details.
Bowtie 2 does not "find" alignments in any specific order, so for reads that have more than N distinct, valid alignments, Bowtie 2 does not gaurantee that the N alignments reported are the best possible in terms of alignment score. Still, this mode can be effective and fast in situations where the user cares more about whether a read aligns (or aligns a certain number of times) than where exactly it originated.
-a mode is similar to -k mode except that there is no upper limit on the number of alignments Bowtie 2 should report. Alignments are reported in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. See the SAM specification for details.
Some tools are designed with this reporting mode in mind. Bowtie 2 is not! For very large genomes, this mode is very slow.
To rapidly narrow the number of possible alignments that must be considered, Bowtie 2 begins by extracting substrings ("seeds") from the read and its reverse complement and aligning them in an ungapped fashion with the help of the FM Index. This is "multiseed alignment" and it is similar to what Bowtie 1 does, except Bowtie 1 attempts to align the entire read this way.
This initial step makes Bowtie 2 much faster than it would be without such a filter, but at the expense of missing some valid alignments. For instance, it is possible for a read to have a valid overall alignment but to have no valid seed alignments because each potential seed alignment is interruped by too many mismatches or gaps.
The tradeoff between speed and sensitivity/accuracy can be adjusted by setting the seed length (-L), the interval between extracted seeds (-i), and the number of mismatches permitted per seed (-N). For more sensitive alignment, set these parameters to (a) make the seeds closer together, (b) make the seeds shorter, and/or (c) allow more mismatches. You can adjust these options one-by-one, though Bowtie 2 comes with some useful combinations of options pre-packaged as "preset options."
-D and -R are also options that adjust the tradeoff between speed and sensitivity/accuracy.
Bowtie 2 uses the FM Index to find ungapped alignments for seeds. This step accounts for the bulk of Bowtie 2's memory footprint, as the FM Index itself is typically the largest data structure used. For instance, the memory footprint of the FM Index for the human genome is about 3.2 gigabytes of RAM.
Non-whitespace characters besides A, C, G or T are considered "ambiguous." N is a common ambiguous character that appears in reference sequences. Bowtie 2 considers all ambiguous characters in the reference (including IUPAC nucleotide codes) to be Ns.
Bowtie 2 allows alignments to overlap ambiguous characters in the reference. An alignment position that contains an ambiguous character in the read, reference, or both, is penalized according to --np. --n-ceil sets an upper limit on the number of positions that may contain ambiguous reference characters in a valid alignment. The optional field XN:i reports the number of ambiguous reference characters overlapped by an alignment.
Note that the multiseed heuristic cannot find seed alignments that overlap ambiguous reference characters. For an alignment overlapping an ambiguous reference character to be found, it must have one or more seed alignments that do not overlap ambiguous reference characters.
Bowtie 2 comes with some useful combinations of parameters packaged into shorter "preset" parameters. For example, running Bowtie 2 with the --very-sensitive option is the same as running with options: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50. The preset options that come with Bowtie 2 are designed to cover a wide area of the speed/sensitivity/accuracy tradeoff space, with the presets ending in fast generally being faster but less sensitive and less accurate, and the presets ending in sensitive generally being slower but more sensitive and more accurate. See the documentation for the preset options for details.
Some reads are skipped or "filtered out" by Bowtie 2. For example, reads may be filtered out because they are extremely short or have a high proportion of ambiguous nucleotides. Bowtie 2 will still print a SAM record for such a read, but no alignment will be reported and and the YF:i SAM optional field will be set to indicate the reason the read was filtered.
YF:Z:LN: the read was filtered becuase it had length less than or equal to the number of seed mismatches set with the -N option.YF:Z:NS: the read was filtered because it contains a number of ambiguous characters (usually N or .) greater than the ceiling specified with --n-ceil.YF:Z:SC: the read was filtered because the read length and the match bonus (set with --ma) are such that the read can't possibly earn an alignment score greater than or equal to the threshold set with --score-minYF:Z:QC: the read was filtered because it was marked as failing quality control and the user specified the --qc-filter option. This only happens when the input is in Illumina's QSEQ format (i.e. when --qseq is specified) and the last (11th) field of the read's QSEQ record contains 1.If a read could be filtered for more than one reason, the value YF:Z flag will reflect only one of those reasons.
When Bowtie 2 finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle. For datasets consisting of unpaired reads, the summary might look like this:
20000 reads; of these:
20000 (100.00%) were unpaired; of these:
1247 (6.24%) aligned 0 times
18739 (93.69%) aligned exactly 1 time
14 (0.07%) aligned >1 times
93.77% overall alignment rate
For datasets consisting of pairs, the summary might look like this:
10000 reads; of these:
10000 (100.00%) were paired; of these:
650 (6.50%) aligned concordantly 0 times
8823 (88.23%) aligned concordantly exactly 1 time
527 (5.27%) aligned concordantly >1 times
----
650 pairs aligned concordantly 0 times; of these:
34 (5.23%) aligned discordantly 1 time
----
616 pairs aligned 0 times concordantly or discordantly; of these:
1232 mates make up the pairs; of these:
660 (53.57%) aligned 0 times
571 (46.35%) aligned exactly 1 time
1 (0.08%) aligned >1 times
96.70% overall alignment rate
The indentation indicates how subtotals relate to totals.
The bowtie2 executable is actually a Perl wrapper script that calls the compiled bowtie2-align binary. It is recommended that you always run the bowtie2 wrapper and not run bowtie2-align directly.
Use 64-bit version if possible
The 64-bit version of Bowtie 2 is faster than the 32-bit version, owing to its use of 64-bit arithmetic. If possible, download the 64-bit binaries for Bowtie 2 and run on a 64-bit computer. If you are building Bowtie 2 from sources, you may need to pass the -m64 option to g++ to compile the 64-bit version; you can do this by including BITS=64 in the arguments to the make command; e.g.: make BITS=64 bowtie2. To determine whether your version of bowtie is 64-bit or 32-bit, run bowtie2 --version.
If your computer has multiple processors/cores, use -p
The -p option causes Bowtie 2 to launch a specified number of parallel search threads. Each thread runs on a different processor/core and all threads find alignments in parallel, increasing alignment throughput by approximately a multiple of the number of threads (though in practice, speedup is somewhat worse than linear).
Some Bowtie 2 options specify a function rather than an individual number or setting. In these cases the user specifies three parameters: (a) a function type F, (b) a constant term B, and (c) a coefficient A. The available function types are constant (C), linear (L), square-root (S), and natural log (G). The parameters are specified as F,B,A - that is, the function type, the constant term, and the coefficient are separated by commas with no whitespace. The constant term and coefficient may be negative and/or floating-point numbers.
For example, if the function specification is L,-0.4,-0.6, then the function defined is:
f(x) = -0.4 + -0.6 * x
If the function specification is G,1,5.4, then the function defined is:
f(x) = 1.0 + 5.4 * ln(x)
See the documentation for the option in question to learn what the parameter x is for. For example, in the case if the --score-min option, the function f(x) sets the minimum alignment score necessary for an alignment to be considered valid, and x is the read length.
bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r>} -S [<hit>]
|
The basename of the index for the reference genome. The basename is the name of any of the index files up to but not including the final |
|
Comma-separated list of files containing mate 1s (filename usually includes |
|
Comma-separated list of files containing mate 2s (filename usually includes |
|
Comma-separated list of files containing unpaired reads to be aligned, e.g. |
|
File to write SAM alignments to. By default, alignments are written to the "standard out" or "stdout" filehandle (i.e. the console). |
|
Reads (specified with |
|
Reads (specified with |
|
Reads (specified with |
|
Reads (specified with |
|
The read sequences are given on command line. I.e. |
|
Skip (i.e. do not align) the first |
|
Align the first |
|
Trim |
|
Trim |
|
Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines. |
|
Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding. |
|
Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3). Default: off. |
|
Quality values are represented in the read input file as space-separated ASCII integers, e.g., |
--end-to-end mode
|
Same as: |
|
Same as: |
|
Same as: |
|
Same as: |
--local mode
|
Same as: |
|
Same as: |
|
Same as: |
|
Same as: |
|
Sets the number of mismatches to allowed in a seed alignment during multiseed alignment. Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity. Default: 0. |
|
Sets the length of the seed substrings to align during multiseed alignment. Smaller values make alignment slower but more senstive. Default: the |
|
Sets a function governing the interval between seed substrings to use during multiseed alignment. For instance, if the read has 30 characers, and seed length is 10, and the seed interval is 6, the seeds extracted will be: Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying |
|
Sets a function governing the maximum number of ambiguous characters (usually |
|
"Pads" dynamic programming problems by |
|
Disallow gaps within |
|
When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value. I.e. input is treated as though all quality values are high. This is also the default behavior when the input doesn't specify quality values (e.g. in |
|
If |
|
In this mode, Bowtie 2 requires that the entire read align from one end to the other, without any trimming (or "soft clipping") of characters from either end. The match bonus |
|
In this mode, Bowtie 2 does not require that the entire read align from one end to the other. Rather, some characters may be omitted ("soft clipped") from the ends in order to achieve the greatest possible alignment score. The match bonus |
|
Sets the match bonus. In |
|
Sets the maximum ( |
|
Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as |
|
Sets the read gap open ( |
|
Sets the reference gap open ( |
|
Sets a function governing the minimum alignment score needed for an alignment to be considered "valid" (i.e. good enough to report). This is a function of read length. For instance, specifying |
|
By default, When Note: Bowtie 2 is not designed with large values for |
|
Like Note: Bowtie 2 is not designed with |
|
Up to |
|
|
|
The minimum fragment length for valid paired-end alignments. E.g. if |
|
The maximum fragment length for valid paired-end alignments. E.g. if |
|
The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. E.g., if |
|
By default, when |
|
By default, |
|
If the mates "dovetail", that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: Mates can overlap, contain or dovetail each other. Default: mates cannot dovetail in a concordant alignment. |
|
If one mate alignment contains the other, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: a mate can contain the other in a concordant alignment. |
|
If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: mates can overlap in a concordant alignment. |
|
Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. Default: off. |
|
Write unpaired reads that fail to align to file at |
|
Write unpaired reads that align at least once to file at |
|
Write paired-end reads that fail to align concordantly to file(s) at |
|
Write paired-end reads that align concordantly at least once to file(s) at |
|
Print nothing besides alignments and serious errors. |
|
Write |
|
Write |
|
Write a new |
|
Suppress SAM records for reads that failed to align. |
|
Suppress SAM header lines (starting with |
|
Suppress |
|
Set the read group ID to |
|
Add |
|
Override the offrate of the index with |
|
Launch |
|
Guarantees that output SAM records are printed in an order corresponding to the order of the reads in the original input file, even when |
|
Use memory-mapped I/O to load the index, rather than typical file I/O. Memory-mapping allows many concurrent |
|
Filter out reads for which the QSEQ filter field is non-zero. Only has an effect when read format is |
|
Use |
|
Print version information and quit. |
|
Print usage information and quit. |
Following is a brief description of the SAM format as output by bowtie2. For more details, see the SAM format specification.
By default, bowtie2 prints a SAM header with @HD, @SQ and @PG lines. When one or more --rg arguments are specified, bowtie2 will also print an @RG line that includes all user-specified --rg tokens separated by tabs.
Each subsequnt line describes an alignment or, if the read failed to align, a read. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are:
Name of read that aligned
Sum of all applicable flags. Flags relevant to Bowtie are:
|
The read is one of a pair |
|
The alignment is one end of a proper paired-end alignment |
|
The read has no reported alignments |
|
The read is one of a pair and has no reported alignments |
|
The alignment is to the reverse reference strand |
|
The other mate in the paired-end alignment is aligned to the reverse reference strand |
|
The read is mate 1 in a pair |
|
The read is mate 2 in a pair |
Thus, an unpaired read that aligns to the reverse reference strand will have flag 16. A paired-end read that aligns and is the first mate in the pair will have flag 83 (= 64 + 16 + 2 + 1).
Name of reference sequence where alignment occurs
1-based offset into the forward reference strand where leftmost character of the alignment occurs
Mapping quality
CIGAR string representation of alignment
Name of reference sequence where mate's alignment occurs. Set to = if the mate's reference sequence is the same as this alignment's, or * if there is no mate.
1-based offset into the forward reference strand where leftmost character of the mate's alignment occurs. Offset is 0 if there is no mate.
Inferred fragment size. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if there is no mate.
Read sequence (reverse-complemented if aligned to the reverse strand)
ASCII-encoded read qualities (reverse-complemented if the read aligned to the reverse strand). The encoded quality values are on the Phred quality scale and the encoding is ASCII-offset by 33 (ASCII char !), similarly to a FASTQ file.
Optional fields. Fields are tab-separated. bowtie2 outputs zero or more of these optional fields for each alignment, depending on the type of the alignment:
|
Alignment score. Can be negative. Can be greater than 0 in | |
|
Alignment score for second-best alignment. Can be negative. Can be greater than 0 in | |
|
Alignment score for opposite mate in the paired-end alignment. Only present if the SAM record is for a read that aligned as part of a paired-end alignment. | |
|
The number of ambiguous bases in the reference covering this alignment. Only present if SAM record is for an aligned read. | |
|
The number of mismatches in the alignment. Only present if SAM record is for an aligned read. | |
|
The number of gap opens, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read. | |
|
The number of gap extensions, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read. | |
|
The edit distance; that is, the minimal number of one-nucleotide edits (substitutions, insertions and deletions) needed to transform the read string into the reference string. Only present if SAM record is for an aligned read. | |
|
String indicating reason why the read was filtered out. See also: Filtering. Only appears for reads that were filtered out. |
Value of |
|
A string representation of the mismatched reference bases in the alignment. See SAM format specification for details. Only present if SAM record is for an aligned read. |
bowtie2-build indexerbowtie2-build builds a Bowtie index from a set of DNA sequences. bowtie2-build outputs a set of 6 files with suffixes .1.bt2, .2.bt2, .3.bt2, .4.bt2, .rev.1.bt2, and .rev.2.bt2. These files together constitute the index: they are all that is needed to align reads to that reference. The original sequence FASTA files are no longer used by Bowtie 2 once the index is built.
Bowtie 2's .bt2 index format is different from Bowtie 1's .ebwt format, and they are not compatible with each other.
Use of Karkkainen's blockwise algorithm allows bowtie2-build to trade off between running time and memory usage. bowtie2-build has three options governing how it makes this trade: -p/--packed, --bmax/--bmaxdivn, and --dcv. By default, bowtie2-build will automatically search for the settings that yield the best running time without exhausting memory. This behavior can be disabled using the -a/--noauto option.
The indexer provides options pertaining to the "shape" of the index, e.g. --offrate governs the fraction of Burrows-Wheeler rows that are "marked" (i.e., the density of the suffix-array sample; see the original FM Index paper for details). All of these options are potentially profitable trade-offs depending on the application. They have been set to defaults that are reasonable for most cases according to our experiments. See Performance tuning for details.
Because bowtie2-build uses 32-bit pointers internally, it can handle up to a theoretical maximum of 2^32-1 (somewhat more than 4 billion) characters in an index, though, with other constraints, the actual ceiling is somewhat less than that. If your reference exceeds 2^32-1 characters, bowtie2-build will print an error message and abort. To resolve this, divide your reference sequences into smaller batches and/or chunks and build a separate index for each.
If your computer has more than 3-4 GB of memory and you would like to exploit that fact to make index building faster, use a 64-bit version of the bowtie2-build binary. The 32-bit version of the binary is restricted to using less than 4 GB of memory. If a 64-bit pre-built binary does not yet exist for your platform on the sourceforge download site, you will need to build one from source.
The Bowtie 2 index is based on the FM Index of Ferragina and Manzini, which in turn is based on the Burrows-Wheeler transform. The algorithm used to build the index is based on the blockwise algorithm of Karkkainen.
Usage:
bowtie2-build [options]* <reference_in> <bt2_base>
|
A comma-separated list of FASTA files containing the reference sequences to be aligned to, or, if |
|
The basename of the index files to write. By default, |
|
The reference input files (specified as |
|
The reference sequences are given on the command line. I.e. |
|
Disable the default behavior whereby |
|
Use a packed (2-bits-per-nucleotide) representation for DNA strings. This saves memory but makes indexing 2-3 times slower. Default: off. This is configured automatically by default; use |
|
The maximum number of suffixes allowed in a block. Allowing more suffixes per block makes indexing faster, but increases peak memory usage. Setting this option overrides any previous setting for |
|
The maximum number of suffixes allowed in a block, expressed as a fraction of the length of the reference. Setting this option overrides any previous setting for |
|
Use |
|
Disable use of the difference-cover sample. Suffix sorting becomes quadratic-time in the worst case (where the worst case is an extremely repetitive reference). Default: off. |
|
Do not build the |
|
Build only the |
|
To map alignments back to positions on the reference sequences, it's necessary to annotate ("mark") some or all of the Burrows-Wheeler rows with their corresponding location on the genome. |
|
The ftab is the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first |
|
Use |
|
Index only the first |
|
|
|
Print usage information and quit. |
|
Print version information and quit. |
bowtie2-inspect index inspectorbowtie2-inspect extracts information from a Bowtie index about what kind of index it is and what reference sequences were used to build it. When run without any options, the tool will output a FASTA file containing the sequences of the original references (with all non-A/C/G/T characters converted to Ns). It can also be used to extract just the reference sequence names using the -n/--names option or a more verbose summary using the -s/--summary option.
Usage:
bowtie2-inspect [options]* <bt2_base>
|
The basename of the index to be inspected. The basename is name of any of the index files but with the |
|
When printing FASTA output, output a newline character every |
|
Print reference sequence names, one per line, and quit. |
|
Print a summary that includes information about index settings, as well as the names and lengths of the input sequences. The summary has this format: Fields are separated by tabs. Colorspace is always set to 0 for Bowtie 2. |
|
Print verbose output (for debugging). |
|
Print version information and quit. |
|
Print usage information and quit. |
Bowtie 2 comes with some example files to get you started. The example files are not scientifically significant; we use the Lambda phage reference genome simply because it's short, and the reads were generated by a computer program, not a sequencer. However, these files will let you start running Bowtie 2 and downstream tools right away.
First follow the manual instructions to obtain Bowtie 2. Set the BT2_HOME environment variable to point to the new Bowtie 2 directory containing the bowtie2, bowtie2-build and bowtie2-inspect binaries. This is important, as the BT2_HOME variable is used in the commands below to refer to that directory.
To create an index for the Lambda phage reference genome included with Bowtie 2, create a new temporary directory (it doesn't matter where), change into that directory, and run:
$BT2_HOME/bowtie2-build $BT2_HOME/example/reference/lambda_virus.fa lambda_virus
The command should print many lines of output then quit. When the command completes, the current directory will contain four new files that all start with lambda_virus and end with .1.bt2, .2.bt2, .3.bt2, .4.bt2, .rev.1.bt2, and .rev.2.bt2. These files constitute the index - you're done!
You can use bowtie2-build to create an index for a set of FASTA files obtained from any source, including sites such as UCSC, NCBI, and Ensembl. When indexing multiple FASTA files, specify all the files using commas to separate file names. For more details on how to create an index with bowtie2-build, see the manual section on index building. You may also want to bypass this process by obtaining a pre-built index. See using a pre-built index below for an example.
Stay in the directory created in the previous step, which now contains the lambda_virus index files. Next, run:
$BT2_HOME/bowtie2 -x lambda_virus -U $BT2_HOME/example/reads/reads_1.fq -S eg1.sam
This runs the Bowtie 2 aligner, which aligns a set of unpaired reads to the Lambda phage reference genome using the index generated in the previous step. The alignment results in SAM format are written to the file eg1.sam, and a short alignment summary is written to the console. (Actually, the summary is written to the "standard error" or "stderr" filehandle, which is typically printed to the console.)
To see the first few lines of the SAM output, run:
head eg1.sam
You will see something like this:
@HD VN:1.0 SO:unsorted
@SQ SN:gi|9626243|ref|NC_001416.1| LN:48502
@PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta2
r1 0 gi|9626243|ref|NC_001416.1| 18401 37 122M * 0 0 TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG +"@6<:27(F&5)9)"B:%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C> AS:i:-5 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:59G13G21G26 YT:Z:UU
r2 0 gi|9626243|ref|NC_001416.1| 8886 37 275M * 0 0 NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC (#!!'+!$""%+(+)'%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(#")(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+ AS:i:-9 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:0A0C0G0A108C23G9T81T46 YT:Z:UU
r3 16 gi|9626243|ref|NC_001416.1| 11599 37 338M * 0 0 GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT 7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04C<E,*AD%G0.%$+A:'H;?8<72:88?E6((CF)6DF#.)=>B>D-="C'B080E'5BH"77':"@70#4%A5=6.2/1>;9"&-H6)=$/0;5E:<8G!@::1?2DC7C*;@*#.1C0.D>H/20,!"C-#,6@%<+<D(AG-).?�.00'@)/F8?B!&"170,)>:?<A7#1(A@0E#&A.*DC.E")AH"+.,5,2>5"2?:G,F"D0B8D-6$65D<D!A/38860.*4;4B<*31?6 AS:i:-22 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:80C4C16A52T23G30A8T76A41 YT:Z:UU
r4 0 gi|9626243|ref|NC_001416.1| 40075 37 184M * 0 0 GGGCCAATGCGCTTACTGATGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGAGAATTAACNGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTCATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGTT (=8B)GD04*G%&4F,1'A>.C&7=F$,+#6!))43C,5/5+)?-/0>/D3=-,2/+.1?@->;)00!'3!7BH$G)HG+ADC'#-9F)7<7"$?&.>0)@5;4,!0-#C!15CF8&HB+B==H>7,/)C5)5*+(F5A%D,EA<(>G9E0>7&/E?4%;#'92)<5+@7:A.(BG@BG86@.G AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:77C106 YT:Z:UU
r5 0 gi|9626243|ref|NC_001416.1| 48010 37 138M * 0 0 GTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTT 9''%<D)A03E1-*7=),:F/0!6,D9:H,<9D%:0B(%'E,(8EFG$E89B$27G8F*2+4,-!,0D5()&=(FGG:5;3*@/.0F-G#5#3->('FDFEG?)5.!)"AGADB3?6(@H(:B<>6!>;>6>G,."?% AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:138 YT:Z:UU
r6 16 gi|9626243|ref|NC_001416.1| 41607 37 72M2D119M * 0 0 TCGATTTGCAAATACCGGAACATCTCGGTAACTGCATATTCTGCATTAAAAAATCAACGCAAAAAATCGGACGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATNCCATGTGCGTGACGGNCATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAATGTCGCT 1H#G;H"$E*E#&"*)2%66?=9/9'=;4)4/>@%+5#@#$4A*!<D=="8#1*A9BA=:(1+#C&.#(3#H=9E)AC*5,AC#E'536*2?)H14?>9'B=7(3H/B:+A:8%1-+#(E%&$$&14"76D?>7(&20H5%*&CF8!G5B+A4F$7(:"'?0$?G+$)B-?2<0<F=D!38BH,%=8&5@+ AS:i:-13 XN:i:0 XM:i:2 XO:i:1 XG:i:2 NM:i:4 MD:Z:72^TT55C15A47 YT:Z:UU
r7 16 gi|9626243|ref|NC_001416.1| 4692 37 143M * 0 0 TCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATCGCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACAGCATTCTGCTCGATATGGACANGCCCGGCGGGATGGTGGCGGGG -"/@*7A0)>2,AAH@&"%B)*5*23B/,)90.B@%=FE,E063C9?,:26$-0:,.,1849'4.;F>FA;76+5&$<C":$!A*,<B,<)@<'85D%C*:)30@85;?.B$05=@95DCDH<53!8G:F:B7/A.E':434> AS:i:-7 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:98G21C22 YT:Z:UU
The first few lines (beginning with @) are SAM header lines, and the rest of the lines are SAM alignments, one line per read or mate. See the Bowtie 2 manual section on SAM output and the SAM specification for details about how to interpret the SAM file format.
To align paired-end reads included with Bowtie 2, stay in the same directory and run:
$BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam
This aligns a set of paired-end reads to the reference genome, with results written to the file eg2.sam.
To use local alignment to align some longer reads included with Bowtie 2, stay in the same directory and run:
$BT2_HOME/bowtie2 --local -x lambda_virus -U $BT2_HOME/example/reads/longreads.fq -S eg3.sam
This aligns the long reads to the reference genome using local alignment, with results written to the file eg3.sam.
SAMtools is a collection of tools for manipulating and analyzing SAM and BAM alignment files. BCFtools is a collection of tools for calling variants and manipulating VCF and BCF files, and it is typically distributed with SAMtools. Using these tools together allows you to get from alignments in SAM format to variant calls in VCF format. This example assumes that samtools and bcftools are installed and that the directories containing these binaries are in your PATH environment variable.
If you haven't already done so above, run the paired-end example. Run it in the same directory where you ran the initial index-building step. Here is the command again:
$BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam
Use samtools view to convert the SAM file into a BAM file. BAM is a the binary format corresponding to the SAM text format. Run:
samtools view -bS eg2.sam > eg2.bam
Use samtools sort to convert the BAM file to a sorted BAM file.
samtools sort eg2.bam eg2.sorted
We now have a sorted BAM file called eg2.sorted.bam. Sorted BAM is a useful format because the alignments are (a) compressed, which is convenient for long-term storage, and (b) sorted, which is conveneint for variant discovery. To generate variant calls in VCF format, run:
samtools mpileup -uf $BT2_HOME/example/reference/lambda_virus.fa eg2.sorted.bam | bcftools view -bvcg - > eg2.raw.bcf
Then to view the variants, run:
bcftools view eg2.raw.bcf
See the official SAMtools guide to Calling SNPs/INDELs with SAMtools/BCFtools for more details and variations on this process.